ID: 1013315682_1013315685

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1013315682 1013315685
Species Human (GRCh38) Human (GRCh38)
Location 6:108940444-108940466 6:108940467-108940489
Sequence CCCAAAGATTGGTTGGACCAGGT GTGATGTTTACATAGCACGCAGG
Strand - +
Off-target summary {0: 53, 1: 91, 2: 79, 3: 86, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!