ID: 1013384787_1013384791

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1013384787 1013384791
Species Human (GRCh38) Human (GRCh38)
Location 6:109615861-109615883 6:109615878-109615900
Sequence CCCGCTCAACTATAAACCAGTCA CAGTCACACCTAAGAATGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115} {0: 1, 1: 0, 2: 0, 3: 5, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!