ID: 1013472391_1013472395

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1013472391 1013472395
Species Human (GRCh38) Human (GRCh38)
Location 6:110476746-110476768 6:110476770-110476792
Sequence CCCAAGTATCTTCGGCTTTTTTC TGCCGCCTCGGCCTCCTTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 185} {0: 1, 1: 0, 2: 2, 3: 55, 4: 424}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!