ID: 1013607592_1013607600

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1013607592 1013607600
Species Human (GRCh38) Human (GRCh38)
Location 6:111764875-111764897 6:111764905-111764927
Sequence CCCTGCTGTGGCTCATTCTCTCT CTTTGCTGGCAGCTGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 246, 4: 1045} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!