ID: 1013738573_1013738581

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1013738573 1013738581
Species Human (GRCh38) Human (GRCh38)
Location 6:113256933-113256955 6:113256984-113257006
Sequence CCACAGAAACCAGCAAATGCTAC CTGGTTTACCAGCATACCACTGG
Strand - +
Off-target summary {0: 3, 1: 7, 2: 40, 3: 169, 4: 519} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!