ID: 1013815753_1013815757

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1013815753 1013815757
Species Human (GRCh38) Human (GRCh38)
Location 6:114095411-114095433 6:114095439-114095461
Sequence CCATGCCTTTCTTCAGGGCTGAT CAAGATGCTCACATGAATATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 306} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!