ID: 1013931155_1013931162

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1013931155 1013931162
Species Human (GRCh38) Human (GRCh38)
Location 6:115534610-115534632 6:115534650-115534672
Sequence CCCAAAGTGCTGGGATTACAGGC GCCATTGTTAAGTTTAAAGAGGG
Strand - +
Off-target summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!