ID: 1013931156_1013931162

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1013931156 1013931162
Species Human (GRCh38) Human (GRCh38)
Location 6:115534611-115534633 6:115534650-115534672
Sequence CCAAAGTGCTGGGATTACAGGCG GCCATTGTTAAGTTTAAAGAGGG
Strand - +
Off-target summary {0: 121435, 1: 268139, 2: 223994, 3: 153979, 4: 220861} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!