|
Left Crispr |
Right Crispr |
| Crispr ID |
1013946165 |
1013946172 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:115725254-115725276
|
6:115725300-115725322
|
| Sequence |
CCTGTTATTGGTCTGCTCAGAGC |
TAGGAGGGTTGTATATTTCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 157, 3: 6177, 4: 3129} |
{0: 161, 1: 558, 2: 595, 3: 439, 4: 656} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|