ID: 1014246730_1014246742

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1014246730 1014246742
Species Human (GRCh38) Human (GRCh38)
Location 6:119078286-119078308 6:119078317-119078339
Sequence CCCGGGGTCGCCATCTTCCCAAC GCCGGGGCACCTGTCCCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 184} {0: 1, 1: 0, 2: 0, 3: 6, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!