ID: 1014378645_1014378646

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1014378645 1014378646
Species Human (GRCh38) Human (GRCh38)
Location 6:120711109-120711131 6:120711131-120711153
Sequence CCTTGGCAGTGGCACATGACATG GAAGAGAGAATCTGTGCACTTGG
Strand - +
Off-target summary No data {0: 6, 1: 24, 2: 61, 3: 156, 4: 556}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!