ID: 1014378645_1014378647

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1014378645 1014378647
Species Human (GRCh38) Human (GRCh38)
Location 6:120711109-120711131 6:120711132-120711154
Sequence CCTTGGCAGTGGCACATGACATG AAGAGAGAATCTGTGCACTTGGG
Strand - +
Off-target summary No data {0: 11, 1: 48, 2: 106, 3: 220, 4: 494}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!