ID: 1014378645_1014378648

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1014378645 1014378648
Species Human (GRCh38) Human (GRCh38)
Location 6:120711109-120711131 6:120711133-120711155
Sequence CCTTGGCAGTGGCACATGACATG AGAGAGAATCTGTGCACTTGGGG
Strand - +
Off-target summary No data {0: 25, 1: 71, 2: 143, 3: 220, 4: 528}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!