ID: 1014674712_1014674724

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1014674712 1014674724
Species Human (GRCh38) Human (GRCh38)
Location 6:124349294-124349316 6:124349331-124349353
Sequence CCCCCTACAAAGGCGGGAACTTC CATTCTCCCAGTGCACAGGCCGG
Strand - +
Off-target summary No data {0: 11, 1: 19, 2: 40, 3: 124, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!