ID: 1014674713_1014674726

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1014674713 1014674726
Species Human (GRCh38) Human (GRCh38)
Location 6:124349295-124349317 6:124349336-124349358
Sequence CCCCTACAAAGGCGGGAACTTCC TCCCAGTGCACAGGCCGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54} {0: 1, 1: 1, 2: 4, 3: 19, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!