ID: 1014674715_1014674729

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1014674715 1014674729
Species Human (GRCh38) Human (GRCh38)
Location 6:124349297-124349319 6:124349347-124349369
Sequence CCTACAAAGGCGGGAACTTCCCG AGGCCGGTTGGGTATTCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 23, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!