ID: 1014674717_1014674730 |
View in Genome Browser |
Spacer: 9 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1014674717 | 1014674730 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:124349316-124349338 | 6:124349348-124349370 |
| Sequence | CCCGAGGCTCCACCCCATTCTCC | GGCCGGTTGGGTATTCTCCAGGG |
| Strand | - | + |
| Off-target summary | {0: 2, 1: 27, 2: 47, 3: 147, 4: 614} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||