|
Left Crispr |
Right Crispr |
Crispr ID |
1014674718 |
1014674724 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:124349317-124349339
|
6:124349331-124349353
|
Sequence |
CCGAGGCTCCACCCCATTCTCCC |
CATTCTCCCAGTGCACAGGCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 22, 2: 43, 3: 127, 4: 777} |
{0: 11, 1: 19, 2: 40, 3: 124, 4: 344} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|