ID: 1014778878_1014778881

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1014778878 1014778881
Species Human (GRCh38) Human (GRCh38)
Location 6:125540765-125540787 6:125540789-125540811
Sequence CCCTTATTTATTTATTTAACACT ATGCCTTAACTGCTGGAGTACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!