ID: 1014837318_1014837327

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1014837318 1014837327
Species Human (GRCh38) Human (GRCh38)
Location 6:126174109-126174131 6:126174148-126174170
Sequence CCTCACCTTTCTGCAGCCTCTCA ACTCCTCATAGGCTATCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 59, 4: 544} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!