ID: 1015095451_1015095453

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1015095451 1015095453
Species Human (GRCh38) Human (GRCh38)
Location 6:129409602-129409624 6:129409629-129409651
Sequence CCAAGAGTTGTCTCTCAAATGGA AGTGATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 2, 1: 18, 2: 203, 3: 201, 4: 332} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!