ID: 1015174318_1015174324

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1015174318 1015174324
Species Human (GRCh38) Human (GRCh38)
Location 6:130289793-130289815 6:130289821-130289843
Sequence CCCAGCCCAAGAAAAGATTTTTA TGTAGTCAGAAGACCTAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 11, 3: 155, 4: 1296} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!