ID: 1015250911_1015250916

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1015250911 1015250916
Species Human (GRCh38) Human (GRCh38)
Location 6:131126773-131126795 6:131126808-131126830
Sequence CCCTGCTCATGGTGTGGTTACAA AGGTTTGAACAAAGAGAAATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 110} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!