ID: 1015315783_1015315789

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1015315783 1015315789
Species Human (GRCh38) Human (GRCh38)
Location 6:131814589-131814611 6:131814615-131814637
Sequence CCTTTTCCTTCCCTTATGATCCA TCTTAACTCTAGAATATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 1142} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!