ID: 1015315784_1015315789

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1015315784 1015315789
Species Human (GRCh38) Human (GRCh38)
Location 6:131814595-131814617 6:131814615-131814637
Sequence CCTTCCCTTATGATCCATTATCT TCTTAACTCTAGAATATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!