ID: 1015381939_1015381948

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1015381939 1015381948
Species Human (GRCh38) Human (GRCh38)
Location 6:132579786-132579808 6:132579824-132579846
Sequence CCTACACATTTCAAGCAGCATGG GTAAGAGGCAGACTGGGATTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!