ID: 1015392774_1015392783

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1015392774 1015392783
Species Human (GRCh38) Human (GRCh38)
Location 6:132701796-132701818 6:132701825-132701847
Sequence CCATCCTCCAGGTTACCACATGG GAGAAAATTTGTGCCCTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 282} {0: 2, 1: 0, 2: 5, 3: 53, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!