ID: 1015392776_1015392787

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1015392776 1015392787
Species Human (GRCh38) Human (GRCh38)
Location 6:132701800-132701822 6:132701847-132701869
Sequence CCTCCAGGTTACCACATGGTGTG GAAGGAAAGTACAGTGATTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 26, 3: 122, 4: 509}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!