ID: 1015392778_1015392780

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1015392778 1015392780
Species Human (GRCh38) Human (GRCh38)
Location 6:132701803-132701825 6:132701822-132701844
Sequence CCAGGTTACCACATGGTGTGGAG GGAGAGAAAATTTGTGCCCTTGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 4, 3: 62, 4: 461}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!