ID: 1015392779_1015392784

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1015392779 1015392784
Species Human (GRCh38) Human (GRCh38)
Location 6:132701811-132701833 6:132701829-132701851
Sequence CCACATGGTGTGGAGAGAAAATT AAATTTGTGCCCTTGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 38, 4: 255} {0: 2, 1: 0, 2: 4, 3: 65, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!