ID: 1015768278_1015768282

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1015768278 1015768282
Species Human (GRCh38) Human (GRCh38)
Location 6:136742477-136742499 6:136742530-136742552
Sequence CCTTACACCCTCTGCAGAAATTA ATGAAAAACTATAAAACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 446, 4: 10344} {0: 2, 1: 9, 2: 39, 3: 151, 4: 780}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!