ID: 1016017903_1016017907

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1016017903 1016017907
Species Human (GRCh38) Human (GRCh38)
Location 6:139204932-139204954 6:139204946-139204968
Sequence CCATCCCCACAGTGGCTGTGGCA GCTGTGGCAAGCCCTGCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 40, 4: 393} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!