ID: 1016086276_1016086280

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1016086276 1016086280
Species Human (GRCh38) Human (GRCh38)
Location 6:139919323-139919345 6:139919367-139919389
Sequence CCAGAGTAGCTGGGACTACAGGC TTGTACTTTTAGAAGAGAGATGG
Strand - +
Off-target summary {0: 71612, 1: 190254, 2: 237127, 3: 179987, 4: 110598} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!