ID: 1016086277_1016086280

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1016086277 1016086280
Species Human (GRCh38) Human (GRCh38)
Location 6:139919351-139919373 6:139919367-139919389
Sequence CCACCACCATTTTTTTTTGTACT TTGTACTTTTAGAAGAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 112, 4: 1387} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!