ID: 1016181774_1016181781

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1016181774 1016181781
Species Human (GRCh38) Human (GRCh38)
Location 6:141155610-141155632 6:141155651-141155673
Sequence CCAACGGTGGAGTCTTCCGAAAG CCTTATCGAAGAAAACCTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 40} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!