ID: 1016257003_1016257008

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1016257003 1016257008
Species Human (GRCh38) Human (GRCh38)
Location 6:142119288-142119310 6:142119317-142119339
Sequence CCACACCAGGATGGGACATATGA CAGGATACCCCCATCTAAATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!