ID: 1016264186_1016264192 |
View in Genome Browser |
Spacer: -10 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1016264186 | 1016264192 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:142212748-142212770 | 6:142212761-142212783 |
| Sequence | CCTCACATGGCAGCAGGAGACAG | CAGGAGACAGAGAGGGAAGGGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 15, 2: 120, 3: 806, 4: 3997} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||