ID: 1016264186_1016264192

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1016264186 1016264192
Species Human (GRCh38) Human (GRCh38)
Location 6:142212748-142212770 6:142212761-142212783
Sequence CCTCACATGGCAGCAGGAGACAG CAGGAGACAGAGAGGGAAGGGGG
Strand - +
Off-target summary {0: 2, 1: 10, 2: 51, 3: 200, 4: 987} {0: 1, 1: 15, 2: 120, 3: 806, 4: 3997}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!