ID: 1016425259_1016425263

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1016425259 1016425263
Species Human (GRCh38) Human (GRCh38)
Location 6:143929258-143929280 6:143929272-143929294
Sequence CCTTCTATGCCTTGTTTGTTGAG TTTGTTGAGGGCATCATGATAGG
Strand - +
Off-target summary {0: 5, 1: 102, 2: 521, 3: 1556, 4: 5792} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!