ID: 1016457169_1016457172

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1016457169 1016457172
Species Human (GRCh38) Human (GRCh38)
Location 6:144243429-144243451 6:144243455-144243477
Sequence CCACAGCACCCGGCTGGAAAAGT TATTTCTCCTTCATGTTTGAAGG
Strand - +
Off-target summary No data {0: 247, 1: 467, 2: 698, 3: 1110, 4: 1532}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!