ID: 1016615356_1016615357

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1016615356 1016615357
Species Human (GRCh38) Human (GRCh38)
Location 6:146041622-146041644 6:146041638-146041660
Sequence CCTACAATGTGGTGCTGCTGAAC GCTGAACCTCCTCTCTGACTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 22, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!