ID: 1016806608_1016806613

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1016806608 1016806613
Species Human (GRCh38) Human (GRCh38)
Location 6:148218348-148218370 6:148218396-148218418
Sequence CCAAAAACATAACCTAACATGTA GTTATTTTACGCTTCAGTAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!