ID: 1016952574_1016952582

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1016952574 1016952582
Species Human (GRCh38) Human (GRCh38)
Location 6:149594468-149594490 6:149594502-149594524
Sequence CCTTCGTGTCCGAGGCCAGCACA GGCTGCCGTGGCCGCATCGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 10, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!