ID: 1016952584_1016952585

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1016952584 1016952585
Species Human (GRCh38) Human (GRCh38)
Location 6:149594513-149594535 6:149594530-149594552
Sequence CCGCATCGTGGGTGTGTCTAAGA CTAAGAAGAAGTAAGTCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 57} {0: 1, 1: 0, 2: 7, 3: 12, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!