ID: 1016990263_1016990278

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1016990263 1016990278
Species Human (GRCh38) Human (GRCh38)
Location 6:149923543-149923565 6:149923583-149923605
Sequence CCAGTCCCATCCCCGCGGCCTCA ACGTGGTTATAGCCTGGGCTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!