ID: 1017015335_1017015339

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1017015335 1017015339
Species Human (GRCh38) Human (GRCh38)
Location 6:150095169-150095191 6:150095219-150095241
Sequence CCTATGAATCCTACCATGGGCTT ACAGAGTCTTGACATATCCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!