ID: 1017217699_1017217701

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1017217699 1017217701
Species Human (GRCh38) Human (GRCh38)
Location 6:151929421-151929443 6:151929444-151929466
Sequence CCATTCCTTTACTTTTAACATAT CAGAGTTATTACATTTAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 36, 3: 288, 4: 1965} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!