ID: 1017237847_1017237851

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1017237847 1017237851
Species Human (GRCh38) Human (GRCh38)
Location 6:152135914-152135936 6:152135960-152135982
Sequence CCGACTACACTCTGGTCACAATG ACTAAGTCCTTTCCTGCTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 33, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!