ID: 1017237847_1017237852

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1017237847 1017237852
Species Human (GRCh38) Human (GRCh38)
Location 6:152135914-152135936 6:152135961-152135983
Sequence CCGACTACACTCTGGTCACAATG CTAAGTCCTTTCCTGCTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129} {0: 1, 1: 0, 2: 0, 3: 34, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!