ID: 1017254056_1017254061

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1017254056 1017254061
Species Human (GRCh38) Human (GRCh38)
Location 6:152313389-152313411 6:152313431-152313453
Sequence CCTATTCAGGCCCCTACGAAGTC TGACATTAGAAAAAACACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43} {0: 1, 1: 0, 2: 1, 3: 52, 4: 606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!