ID: 1017402529_1017402532

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1017402529 1017402532
Species Human (GRCh38) Human (GRCh38)
Location 6:154080667-154080689 6:154080700-154080722
Sequence CCCATCTGCTCACATGATTAGAA TCTGGTGACCCGTACGTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!